Archives

  • 2026-07
  • 2026-06
  • 2026-05
  • 2026-04
  • 2026-03
  • 2026-02
  • 2026-01
  • 2025-12
  • 2025-11
  • 2025-10
  • Influenza Hemagglutinin (HA) Peptide: Precision Tag for P...

    2026-03-10

    Influenza Hemagglutinin (HA) Peptide: Precision Tag for Protein Purification

    Principle and Experimental Setup: The Foundation of HA Tagging

    The Influenza Hemagglutinin (HA) Peptide is a synthetic nine-amino acid sequence (YPYDVPDYA) derived from the epitope region of the human influenza hemagglutinin protein. As an epitope tag for protein detection, it is widely integrated into the C- or N-terminus of recombinant proteins via genetic engineering. This compact and hydrophilic peptide enables high-affinity recognition by Anti-HA antibodies, facilitating immunoprecipitation, protein purification, and precise elution in a range of molecular biology applications.

    The HA tag sequence and its corresponding ha tag dna sequence (encoding TATCCGTACGATGTCCCGGATTACG) are broadly utilized in plasmid construction for expressing HA-tagged fusion proteins. These HA-tagged constructs can be tracked, quantified, and purified using anti-HA reagents, leveraging the competitive binding of the HA peptide to displace target proteins during elution. Because of its high solubility (≥55.1 mg/mL in DMSO, ≥100.4 mg/mL in ethanol, and ≥46.2 mg/mL in water) and purity (>98%, confirmed by HPLC and MS), the HA peptide supports a variety of buffer systems and experimental conditions, making it a gold standard for protein-protein interaction studies and immunoprecipitation with Anti-HA antibody.

    Step-By-Step Workflow: Enhancing Immunoprecipitation and Protein Purification

    1. Expression of HA-Tagged Proteins

    • Clone the gene of interest into an expression vector containing the ha tag nucleotide sequence.
    • Transfect or transform the construct into appropriate host cells (e.g., HEK293, CHO, or yeast).
    • Induce protein expression and harvest cells at optimal time points, as determined by western blot or functional assay.

    2. Lysis and Preparation of Cell Extracts

    • Lyse cells in a buffer compatible with downstream immunoprecipitation (e.g., 50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, protease inhibitors).
    • Clarify lysates by centrifugation (e.g., 12,000g, 10 min, 4°C), reserving supernatant.

    3. Immunoprecipitation with Anti-HA Antibody

    • Incubate clarified lysates with Anti-HA Magnetic Beads or conventional beads pre-coupled with Anti-HA antibody.
    • Rotate at 4°C for 1–4 hours (or overnight for low-abundance targets) to maximize binding.
    • Wash beads extensively (3–5 times) with lysis buffer to remove non-specifically bound proteins.

    4. Elution Using Influenza Hemagglutinin (HA) Peptide

    • Prepare a fresh solution of HA peptide at 1–3 mg/mL in buffer (e.g., PBS or Tris-buffered saline).
    • Add 50–200 μL of HA peptide solution to beads and incubate for 30–60 min at 4°C with gentle agitation.
    • Collect supernatant containing the eluted HA fusion protein (HA fusion protein elution peptide principle).

    Quantitative elution efficiency can reach over 90% of bound HA-tagged proteins, with minimal bead contamination, as reported in comparative studies (complementary article).

    5. Downstream Analysis

    • Analyze eluted proteins by SDS-PAGE, western blotting (with secondary anti-HA antibody for specificity), or mass spectrometry.
    • For protein-protein interaction studies, perform co-immunoprecipitation, followed by detection of interacting partners.

    Advanced Applications and Comparative Advantages

    1. Exosome Biology and Secretory Pathways

    The Influenza Hemagglutinin (HA) Peptide has become a pivotal molecular biology peptide tag in the investigation of exosome biogenesis and trafficking, as highlighted by the recent study on RAB31-mediated ESCRT-independent exosome pathways. By tagging regulatory proteins (e.g., RAB GTPases, flotillins) with the HA tag, researchers can track their incorporation into exosomal fractions and dissect their interaction networks within multivesicular endosomes (MVEs). The competitive binding to Anti-HA antibody permits selective elution, minimizing background and facilitating the identification of cargo proteins involved in vesicle sorting and secretion.

    2. Protein-Protein Interaction Studies

    High-affinity HA peptide elution is particularly advantageous in mapping protein complexes and transient interactions. The small size of the tag (ha peptide) preserves native protein structure and function, reducing steric hindrance that can confound larger tags. Quantitative recovery and preservation of post-translational modifications have been demonstrated in workflows leveraging the HA tag peptide (contrasting article), making it suitable for sensitive applications such as phosphoproteomics and ubiquitinylation studies.

    3. Benchmarking Against Alternative Tags

    While other protein purification tags (e.g., FLAG, Myc, His) are widely used, the HA tag offers a unique balance of minimal immunogenicity, high specificity, and compatibility with a broad spectrum of anti-HA reagents. Comparative analyses (extension article) highlight the consistent recovery rates and low background of HA-tagged proteins, especially in complex lysate backgrounds or mammalian systems. Furthermore, the robust solubility of the APExBIO-supplied peptide supports flexible buffer optimization, unlike some alternative tags with solubility constraints.

    Troubleshooting and Optimization Tips

    • Low Recovery in Elution: Ensure the HA peptide is freshly prepared; avoid repeated freeze-thaw cycles. Increase peptide concentration up to 5 mg/mL or extend incubation to 90 minutes for recalcitrant complexes.
    • Non-Specific Binding: Incorporate additional wash steps with higher salt (up to 500 mM NaCl) or include 0.1% Triton X-100. Pre-clear lysates with control beads to reduce background.
    • Eluted Protein Degradation: Add protease and phosphatase inhibitors to buffers. Work at 4°C, and minimize time between elution and downstream analysis.
    • Bead Carryover: Use magnetic separation for rapid, bead-free supernatant recovery. For conventional beads, centrifuge at low speed and avoid disturbing pellet.
    • HA Tag Accessibility: Confirm HA tag is exposed (not buried within protein structure or oligomeric complexes) by testing different tag orientations (N- vs C-terminal) or inserting flexible linkers.

    For advanced troubleshooting and workflow refinement, consult complementary resources such as the in-depth exosome analysis and the translational precision guide; these articles extend mechanistic insights and offer stepwise optimization strategies for HA tag-based purification and detection workflows.

    Future Outlook: Evolving Frontiers in HA Peptide Tagging

    The utility of the hemagglutinin tag is expanding as researchers move toward single-cell proteomics, high-throughput screening, and multiplexed protein interaction mapping. Integration with advanced mass spectrometry and next-generation sequencing platforms (e.g., for analyzing the ha tag dna sequence or monitoring expression via the ha tag nucleotide sequence) is expected to streamline discovery pipelines. Ongoing research—such as the elucidation of non-canonical vesicle secretion pathways (RAB31 study)—will continue to leverage the versatility of the Influenza Hemagglutinin (HA) Peptide in dissecting molecular networks driving disease, immune signaling, and cellular communication.

    As a trusted supplier, APExBIO consistently delivers HA tag peptides with validated purity, solubility, and performance metrics, ensuring reproducibility and scalability for both foundational research and translational applications. Researchers can anticipate further innovations—such as next-generation epitope tags and engineered Anti-HA antibodies—building on the proven strengths of the HA tag system.

    Conclusion

    The Influenza Hemagglutinin (HA) Peptide stands at the forefront of molecular biology as a high-performance, adaptable protein purification tag. Its proven efficacy in immunoprecipitation, competitive elution, exosome biology, and protein-protein interaction studies distinguishes it from conventional tags. By implementing the best practices and troubleshooting guidance outlined here, researchers can maximize yield, specificity, and experimental insight, driving forward the frontiers of cell biology, proteomics, and translational research.