Influenza Hemagglutinin (HA) Peptide: Precision Epitope T...
Influenza Hemagglutinin (HA) Peptide: Precision Epitope Tag for Molecular Biology
Executive Summary: The Influenza Hemagglutinin (HA) Peptide is a synthetic epitope tag (sequence: YPYDVPDYA) derived from the influenza virus hemagglutinin protein and is widely used in molecular biology for protein tagging, detection, and purification (APExBIO). The peptide’s high solubility in DMSO (≥55.1 mg/mL), ethanol (≥100.4 mg/mL), and water (≥46.2 mg/mL) allows for flexible workflow integration. Its specificity enables competitive elution of HA-tagged proteins from Anti-HA antibody matrices, ensuring minimal cross-reactivity (Wei et al., 2021). The A6004 kit from APExBIO guarantees >98% purity, validated by HPLC and mass spectrometry. Reliable use of the HA tag peptide enhances reproducibility in protein-protein interaction and immunoprecipitation studies (Pamidronatedisodium.com).
Biological Rationale
The HA tag peptide (sequence: YPYDVPDYA) originates from the human influenza hemagglutinin protein, specifically the 98–106 amino acid region of HA1. This region is highly immunogenic and recognized by monoclonal Anti-HA antibodies, enabling its use as a molecular tag (Wei et al., 2021). The small size (9 amino acids; ~1 kDa) minimizes disruption to the structure or function of fusion proteins (Pamidronatedisodium.com). The tag’s sequence is not found in most eukaryotic or prokaryotic proteins, leading to high specificity and low background in detection workflows. The HA tag is a benchmark for epitope tagging, enabling reliable detection, purification, and elution of fusion proteins in diverse species.
Mechanism of Action of Influenza Hemagglutinin (HA) Peptide
The Influenza Hemagglutinin (HA) Peptide acts as a competitive ligand for Anti-HA antibodies used in immunoprecipitation (IP), Western blot, and affinity purification. During elution, the free HA peptide competes with the immobilized HA-tagged protein for antibody binding sites, releasing the target protein from the antibody matrix (GDC-0449.com). The process is highly specific, as the Anti-HA antibody recognizes the linear epitope sequence YPYDVPDYA. This allows for controlled and gentle elution conditions, preserving protein complexes and functional conformations. The HA tag can be incorporated at the N- or C-terminus of a recombinant protein via standard cloning techniques, using the corresponding DNA sequence (TACCCATACGACGTCCCAGACTACGCT).
Evidence & Benchmarks
- HA tag peptide enables competitive elution of HA-tagged proteins during immunoprecipitation, maintaining protein activity and complex integrity (Wei et al., 2021, DOI).
- APExBIO’s A6004 product achieves >98% purity, as verified by HPLC and mass spectrometry, supporting high reproducibility in experimental workflows (product page).
- The HA tag sequence does not cross-react with major mammalian proteins, ensuring specificity in Western blot and IP applications (Pamidronatedisodium.com).
- Solubility tests confirm that the peptide dissolves at ≥55.1 mg/mL in DMSO, ≥100.4 mg/mL in ethanol, and ≥46.2 mg/mL in water at room temperature (APExBIO, link).
- The nine-amino acid length of the HA tag ensures minimal interference with protein folding or function, as validated by structural and functional studies (Wei et al., 2021, DOI).
Applications, Limits & Misconceptions
The HA tag peptide is essential for:
- Immunoprecipitation and competitive elution of HA-tagged proteins using Anti-HA antibody-based systems.
- Protein detection via Western blot, ELISA, and immunofluorescence.
- Protein-protein interaction studies, including exosome pathway analysis (Wei et al.).
- Affinity purification and gentle recovery of intact protein complexes.
For a broader perspective on the strategic value of HA tag peptide, see this analysis, which complements the present article by emphasizing translational research impact.
Common Pitfalls or Misconceptions
- HA peptide cannot displace proteins bound via non-HA epitope tags (e.g., FLAG, Myc).
- Excessive peptide concentrations can lead to antibody denaturation or column fouling.
- Long-term storage of HA peptide solutions at room temperature or 4°C leads to degradation; always store desiccated at -20°C (APExBIO).
- The HA tag does not significantly alter protein localization, but steric hindrance is possible with large or poorly folded fusion partners (internal article extends this with case studies).
- Cross-reactivity may occur with rare, endogenous viral proteins in specific cell models; always include negative controls.
Workflow Integration & Parameters
To use the Influenza Hemagglutinin (HA) Peptide for protein elution:
- Express the HA-tagged protein in the target system (mammalian, yeast, or bacterial).
- Lysate preparation and clarification per standard protocols.
- Bind lysate to an anti-HA antibody matrix (magnetic beads or agarose).
- Wash to remove non-specifically bound proteins.
- Add synthetic HA peptide (typically 1 mg/mL in PBS or TBS) to elute the HA-tagged protein by competitive displacement.
- Collect eluted fractions for downstream analysis.
For troubleshooting and advanced workflows, APExBIO’s guide (GDC-0449.com) expands on elution strategies and buffer optimization, complementing the mechanistic and performance focus here.
APExBIO recommends using the A6004 kit for optimal purity and consistency (product page).
Conclusion & Outlook
The Influenza Hemagglutinin (HA) Peptide remains a gold-standard tool for epitope tagging, detection, and competitive elution in protein science. Its high specificity, solubility, and minimal impact on protein function make it invaluable for complex molecular workflows. As protein interaction studies and exosome research advance, validated reagents like APExBIO’s HA tag peptide are essential for experimental rigor. For a deeper dive into mechanistic precision and translational impact, see this recent update, which builds upon the foundational data provided here. Future developments may focus on multiplexed tagging strategies and engineered epitope variants, but the HA tag remains a robust choice for most applications.